Usually, this refers to metals or something that should be solid, such as gold or thin sheets of iron. Something that is malleable is easily changed shape. The velvety peel of the peach meant that it was ready to eat and would be very sweet.I chose this blue and white jacket over the purple one because I like the velvety lining of the inside of this jacket.The velvety texture of the chocolate cake was incredible, and James ended up eating four pieces before the wedding was over.If you are describing real velvet, it is unlikely that you would describe it as velvety because it is implied that this is the case inherently. This often refers to something that should feel this way, such as a rug, but can also refer to the feeling of materials such as leather. If something feels velvety, it usually has extremely soft fur on its side, similar to real velvet. The mushy wet sand was a delight for the children on their summer vacation to the beach.Ted does not like mushy foods, but luckily his wife really likes them.The mushy banana was no longer good for eating directly, but was not a problem for using to make banana bread for the potluck.

An example could be applesauce, or a muddy piece of land after heavy rains. Nstead of being completely solid, such as a rock, or completely liquid, such as water, mushy things feel like a combination of the two. 19:241, 1976.Something that is mushy takes on a feeling that is in between liquid and solid. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. carotovora type strain ATCC 15713 (GenBank Accession No. A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. All strains caused soft rot within a week. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (10 6 CFU/ml) on potato slices (cv.

carotovora by the following deterministic tests: all strains were gram-negative rods oxidase negative facultatively anaerobic able to degrade pectate sensitive to erythromycin negative for phosphatase unable to produce acid from РћВ±-methyl-glucoside and produced acid from trehalose. After purification on tripticase soy agar medium, 17 isolates were identified as E. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 Р’В± 1РІВРЉ. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. The rotted tissues were white-to-cream colored. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area.

Soft synonym